It ’ll soon be easier than ever to get your hand on DNA digital data storage – although it wo n’t come tattily . Gallic startup Biomemory is sell a mention circuit board - sized equipment that can store short message encoded by DNA .
DNAis essentially a natural repository of data , encode genetic info using four base bases ( A , G , C , and MT ) . This is not dissimilar to the way digital data is stored by binary codification through 0s and 1s .
DNA is unbelievably effective at storing information , open of storing 215 petabyte ( 215 million gigabytes ) in a single gram . It’sestimatedthat DNA , in theory , could lay in the totality of all the humans ’s datum in one way . Alternatively , youcould storearound 36 million copy of a 720p HD feature film - length film within just one gram of DNA .
Building on this thought , scientists have recently beentoying aroundwith the idea of using DNA to stash away data just like you would on a hard drive .
Biomemory is now bringing this technology to the public for the first time . With a price tag of $ 1,000 , theirDNA Cardswill allow users to store 1024 bytes of text edition , which is roughly 200 word .
" The launch of our DNA Cards represents a pregnant milestone in the evolution of data storage engineering . After geezerhood of public lecture about the electric potential of molecular computing , we are unbelievably proud to work the first DNA datum storage product to market place , that not only push the boundary of design but also aligns with our commitment to environmental sustainability and efficiency , " Erfane Arwani , CEO of Biomemory , said in astatement .
So , for example , the Word of God “ hello ” could be encoded onto the scorecard by creating a unequalled strand of DNA using the bases “ AGTCTCACAGTCAGAGAGTCTGACAGTCTGACAGTCTGTG ” , according to a " DNA Translate " feature on Biomemory ’s website . Once this data is encoded , you ’ll be mail two plug-in stop the DNA .
To retrieve the data , you ’ll have to station one of the cards to Eurofins Genomics , a German - base biotech company that offer DNA sequence services . You wo n’t be able to retrieve the card after the data has been decoded , hence why you receive two identity card . The lab will then be able to evidence you the message encode onto the card .
For now , this ware is fundamentally a cogent evidence - of - conception , rather than a executable option to retentivity sticks .
Given the enormous potential , there ’s still a foresightful way to go before DNA digital data storage becomes a virtual alternative to ceremonious means of digital storage . However , that is in the end the mission of Biomemory , which point to use DNA - based memory in data point centers . Not only could this dramatically reduce the size of it of data center , it could potentially make them less energy - intensive , which isgood intelligence for the planet .